ID: 1102738477

View in Genome Browser
Species Human (GRCh38)
Location 12:115184739-115184761
Sequence TGCAGACATATTGCATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102738472_1102738477 3 Left 1102738472 12:115184713-115184735 CCCTGCTGCATCTCCAGAACCCA No data
Right 1102738477 12:115184739-115184761 TGCAGACATATTGCATGTCCTGG No data
1102738474_1102738477 -10 Left 1102738474 12:115184726-115184748 CCAGAACCCAACATGCAGACATA No data
Right 1102738477 12:115184739-115184761 TGCAGACATATTGCATGTCCTGG No data
1102738473_1102738477 2 Left 1102738473 12:115184714-115184736 CCTGCTGCATCTCCAGAACCCAA No data
Right 1102738477 12:115184739-115184761 TGCAGACATATTGCATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102738477 Original CRISPR TGCAGACATATTGCATGTCC TGG Intergenic
No off target data available for this crispr