ID: 1102738479

View in Genome Browser
Species Human (GRCh38)
Location 12:115184761-115184783
Sequence GAAAATGTTTGTTGAATGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102738473_1102738479 24 Left 1102738473 12:115184714-115184736 CCTGCTGCATCTCCAGAACCCAA No data
Right 1102738479 12:115184761-115184783 GAAAATGTTTGTTGAATGAGCGG No data
1102738476_1102738479 5 Left 1102738476 12:115184733-115184755 CCAACATGCAGACATATTGCATG No data
Right 1102738479 12:115184761-115184783 GAAAATGTTTGTTGAATGAGCGG No data
1102738472_1102738479 25 Left 1102738472 12:115184713-115184735 CCCTGCTGCATCTCCAGAACCCA No data
Right 1102738479 12:115184761-115184783 GAAAATGTTTGTTGAATGAGCGG No data
1102738475_1102738479 6 Left 1102738475 12:115184732-115184754 CCCAACATGCAGACATATTGCAT No data
Right 1102738479 12:115184761-115184783 GAAAATGTTTGTTGAATGAGCGG No data
1102738474_1102738479 12 Left 1102738474 12:115184726-115184748 CCAGAACCCAACATGCAGACATA No data
Right 1102738479 12:115184761-115184783 GAAAATGTTTGTTGAATGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102738479 Original CRISPR GAAAATGTTTGTTGAATGAG CGG Intergenic
No off target data available for this crispr