ID: 1102739821

View in Genome Browser
Species Human (GRCh38)
Location 12:115197202-115197224
Sequence CAGGGTTGCAAGGAAGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102739821_1102739830 22 Left 1102739821 12:115197202-115197224 CCTGATGCTTCCTTGCAACCCTG No data
Right 1102739830 12:115197247-115197269 GCTGTCTCTTTCGGCTCTGGGGG No data
1102739821_1102739825 13 Left 1102739821 12:115197202-115197224 CCTGATGCTTCCTTGCAACCCTG No data
Right 1102739825 12:115197238-115197260 ACCTTTGTAGCTGTCTCTTTCGG No data
1102739821_1102739828 20 Left 1102739821 12:115197202-115197224 CCTGATGCTTCCTTGCAACCCTG No data
Right 1102739828 12:115197245-115197267 TAGCTGTCTCTTTCGGCTCTGGG No data
1102739821_1102739829 21 Left 1102739821 12:115197202-115197224 CCTGATGCTTCCTTGCAACCCTG No data
Right 1102739829 12:115197246-115197268 AGCTGTCTCTTTCGGCTCTGGGG No data
1102739821_1102739827 19 Left 1102739821 12:115197202-115197224 CCTGATGCTTCCTTGCAACCCTG No data
Right 1102739827 12:115197244-115197266 GTAGCTGTCTCTTTCGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102739821 Original CRISPR CAGGGTTGCAAGGAAGCATC AGG (reversed) Intergenic
No off target data available for this crispr