ID: 1102740631

View in Genome Browser
Species Human (GRCh38)
Location 12:115204457-115204479
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102740631_1102740637 -8 Left 1102740631 12:115204457-115204479 CCTGCCTGGCCCTCCTCCCAGCA No data
Right 1102740637 12:115204472-115204494 TCCCAGCAAAACATCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102740631 Original CRISPR TGCTGGGAGGAGGGCCAGGC AGG (reversed) Intergenic