ID: 1102740637

View in Genome Browser
Species Human (GRCh38)
Location 12:115204472-115204494
Sequence TCCCAGCAAAACATCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102740631_1102740637 -8 Left 1102740631 12:115204457-115204479 CCTGCCTGGCCCTCCTCCCAGCA No data
Right 1102740637 12:115204472-115204494 TCCCAGCAAAACATCCCAGGAGG No data
1102740629_1102740637 -6 Left 1102740629 12:115204455-115204477 CCCCTGCCTGGCCCTCCTCCCAG No data
Right 1102740637 12:115204472-115204494 TCCCAGCAAAACATCCCAGGAGG No data
1102740630_1102740637 -7 Left 1102740630 12:115204456-115204478 CCCTGCCTGGCCCTCCTCCCAGC No data
Right 1102740637 12:115204472-115204494 TCCCAGCAAAACATCCCAGGAGG No data
1102740628_1102740637 -3 Left 1102740628 12:115204452-115204474 CCTCCCCTGCCTGGCCCTCCTCC No data
Right 1102740637 12:115204472-115204494 TCCCAGCAAAACATCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102740637 Original CRISPR TCCCAGCAAAACATCCCAGG AGG Intergenic