ID: 1102742361

View in Genome Browser
Species Human (GRCh38)
Location 12:115219282-115219304
Sequence GATCTCCAACGGATACACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102742361_1102742365 -4 Left 1102742361 12:115219282-115219304 CCGTGGTGTATCCGTTGGAGATC No data
Right 1102742365 12:115219301-115219323 GATCCTAAGGGACCACAGTCTGG No data
1102742361_1102742369 9 Left 1102742361 12:115219282-115219304 CCGTGGTGTATCCGTTGGAGATC No data
Right 1102742369 12:115219314-115219336 CACAGTCTGGTGAGGTCTTAAGG No data
1102742361_1102742367 1 Left 1102742361 12:115219282-115219304 CCGTGGTGTATCCGTTGGAGATC No data
Right 1102742367 12:115219306-115219328 TAAGGGACCACAGTCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102742361 Original CRISPR GATCTCCAACGGATACACCA CGG (reversed) Intergenic
No off target data available for this crispr