ID: 1102746865

View in Genome Browser
Species Human (GRCh38)
Location 12:115256610-115256632
Sequence ATGCAAAAACAGGTTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102746862_1102746865 -2 Left 1102746862 12:115256589-115256611 CCTGTGTTGTGTTTCAAAAGCAT No data
Right 1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG No data
1102746861_1102746865 6 Left 1102746861 12:115256581-115256603 CCAACAAGCCTGTGTTGTGTTTC No data
Right 1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG No data
1102746860_1102746865 7 Left 1102746860 12:115256580-115256602 CCCAACAAGCCTGTGTTGTGTTT No data
Right 1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102746865 Original CRISPR ATGCAAAAACAGGTTGAGCA GGG Intergenic
No off target data available for this crispr