ID: 1102746988

View in Genome Browser
Species Human (GRCh38)
Location 12:115258064-115258086
Sequence ATGGAGAGGAAAAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102746988_1102746994 -8 Left 1102746988 12:115258064-115258086 CCTTCCCCATTTTTCCTCTCCAT No data
Right 1102746994 12:115258079-115258101 CTCTCCATGGTTCTGTATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102746988 Original CRISPR ATGGAGAGGAAAAATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr