ID: 1102747093

View in Genome Browser
Species Human (GRCh38)
Location 12:115258712-115258734
Sequence GGCTCAAGTGAGTCCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102747093_1102747100 11 Left 1102747093 12:115258712-115258734 CCAACATGGGACTCACTTGAGCC No data
Right 1102747100 12:115258746-115258768 TAGGAGCAGGGATGGTCTTCAGG No data
1102747093_1102747101 12 Left 1102747093 12:115258712-115258734 CCAACATGGGACTCACTTGAGCC No data
Right 1102747101 12:115258747-115258769 AGGAGCAGGGATGGTCTTCAGGG No data
1102747093_1102747094 -8 Left 1102747093 12:115258712-115258734 CCAACATGGGACTCACTTGAGCC No data
Right 1102747094 12:115258727-115258749 CTTGAGCCCATGAGAAGCTTAGG No data
1102747093_1102747098 -1 Left 1102747093 12:115258712-115258734 CCAACATGGGACTCACTTGAGCC No data
Right 1102747098 12:115258734-115258756 CCATGAGAAGCTTAGGAGCAGGG No data
1102747093_1102747099 3 Left 1102747093 12:115258712-115258734 CCAACATGGGACTCACTTGAGCC No data
Right 1102747099 12:115258738-115258760 GAGAAGCTTAGGAGCAGGGATGG No data
1102747093_1102747096 -2 Left 1102747093 12:115258712-115258734 CCAACATGGGACTCACTTGAGCC No data
Right 1102747096 12:115258733-115258755 CCCATGAGAAGCTTAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102747093 Original CRISPR GGCTCAAGTGAGTCCCATGT TGG (reversed) Intergenic
No off target data available for this crispr