ID: 1102747692

View in Genome Browser
Species Human (GRCh38)
Location 12:115264031-115264053
Sequence TACATCAGTACTGCTTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102747690_1102747692 10 Left 1102747690 12:115263998-115264020 CCAAAAGAAGTTCTTATGATGAT No data
Right 1102747692 12:115264031-115264053 TACATCAGTACTGCTTAATATGG No data
1102747689_1102747692 11 Left 1102747689 12:115263997-115264019 CCCAAAAGAAGTTCTTATGATGA No data
Right 1102747692 12:115264031-115264053 TACATCAGTACTGCTTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102747692 Original CRISPR TACATCAGTACTGCTTAATA TGG Intergenic
No off target data available for this crispr