ID: 1102757233

View in Genome Browser
Species Human (GRCh38)
Location 12:115352085-115352107
Sequence GGTTTTCAGGGGCTAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102757233_1102757241 3 Left 1102757233 12:115352085-115352107 CCCTCCACTAGCCCCTGAAAACC No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757233_1102757240 2 Left 1102757233 12:115352085-115352107 CCCTCCACTAGCCCCTGAAAACC No data
Right 1102757240 12:115352110-115352132 CATTCTACTTTCTGTTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102757233 Original CRISPR GGTTTTCAGGGGCTAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr