ID: 1102757241

View in Genome Browser
Species Human (GRCh38)
Location 12:115352111-115352133
Sequence ATTCTACTTTCTGTTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102757237_1102757241 -9 Left 1102757237 12:115352097-115352119 CCCTGAAAACCAGCATTCTACTT No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757227_1102757241 19 Left 1102757227 12:115352069-115352091 CCCCAACAACCACACCCCCTCCA No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757229_1102757241 17 Left 1102757229 12:115352071-115352093 CCAACAACCACACCCCCTCCACT No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757238_1102757241 -10 Left 1102757238 12:115352098-115352120 CCTGAAAACCAGCATTCTACTTT No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757234_1102757241 2 Left 1102757234 12:115352086-115352108 CCTCCACTAGCCCCTGAAAACCA No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757233_1102757241 3 Left 1102757233 12:115352085-115352107 CCCTCCACTAGCCCCTGAAAACC No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757232_1102757241 4 Left 1102757232 12:115352084-115352106 CCCCTCCACTAGCCCCTGAAAAC No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757230_1102757241 10 Left 1102757230 12:115352078-115352100 CCACACCCCCTCCACTAGCCCCT No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757228_1102757241 18 Left 1102757228 12:115352070-115352092 CCCAACAACCACACCCCCTCCAC No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757235_1102757241 -1 Left 1102757235 12:115352089-115352111 CCACTAGCCCCTGAAAACCAGCA No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757236_1102757241 -8 Left 1102757236 12:115352096-115352118 CCCCTGAAAACCAGCATTCTACT No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data
1102757231_1102757241 5 Left 1102757231 12:115352083-115352105 CCCCCTCCACTAGCCCCTGAAAA No data
Right 1102757241 12:115352111-115352133 ATTCTACTTTCTGTTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102757241 Original CRISPR ATTCTACTTTCTGTTTATAT GGG Intergenic
No off target data available for this crispr