ID: 1102759585

View in Genome Browser
Species Human (GRCh38)
Location 12:115374105-115374127
Sequence GGTCAGACTCTCCCACAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102759582_1102759585 12 Left 1102759582 12:115374070-115374092 CCAGGAGGAAGAGAATATGGCTT No data
Right 1102759585 12:115374105-115374127 GGTCAGACTCTCCCACAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102759585 Original CRISPR GGTCAGACTCTCCCACAGAT TGG Intergenic
No off target data available for this crispr