ID: 1102760359

View in Genome Browser
Species Human (GRCh38)
Location 12:115379864-115379886
Sequence CTGTCTAAAGGGCAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102760359_1102760367 14 Left 1102760359 12:115379864-115379886 CCACCTTCCTGCCCTTTAGACAG No data
Right 1102760367 12:115379901-115379923 TCCTCAATCAAAAATATTCGAGG No data
1102760359_1102760369 15 Left 1102760359 12:115379864-115379886 CCACCTTCCTGCCCTTTAGACAG No data
Right 1102760369 12:115379902-115379924 CCTCAATCAAAAATATTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102760359 Original CRISPR CTGTCTAAAGGGCAGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr