ID: 1102760359 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:115379864-115379886 |
| Sequence | CTGTCTAAAGGGCAGGAAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1102760359_1102760367 | 14 | Left | 1102760359 | 12:115379864-115379886 | CCACCTTCCTGCCCTTTAGACAG | No data | ||
| Right | 1102760367 | 12:115379901-115379923 | TCCTCAATCAAAAATATTCGAGG | No data | ||||
| 1102760359_1102760369 | 15 | Left | 1102760359 | 12:115379864-115379886 | CCACCTTCCTGCCCTTTAGACAG | No data | ||
| Right | 1102760369 | 12:115379902-115379924 | CCTCAATCAAAAATATTCGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1102760359 | Original CRISPR | CTGTCTAAAGGGCAGGAAGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||