ID: 1102763287

View in Genome Browser
Species Human (GRCh38)
Location 12:115408290-115408312
Sequence GTTTCTGAGGGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102763277_1102763287 29 Left 1102763277 12:115408238-115408260 CCCAAATGTAGTAGTGTCTGGGC No data
Right 1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG No data
1102763280_1102763287 -7 Left 1102763280 12:115408274-115408296 CCTGTAATCTCCAGCAGTTTCTG No data
Right 1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG No data
1102763278_1102763287 28 Left 1102763278 12:115408239-115408261 CCAAATGTAGTAGTGTCTGGGCT No data
Right 1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102763287 Original CRISPR GTTTCTGAGGGGAAGGTGGA AGG Intergenic
No off target data available for this crispr