ID: 1102767515

View in Genome Browser
Species Human (GRCh38)
Location 12:115446430-115446452
Sequence CAACTGGGGCTCAAATAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102767507_1102767515 14 Left 1102767507 12:115446393-115446415 CCTTTACATATGTGGCATCTGGG No data
Right 1102767515 12:115446430-115446452 CAACTGGGGCTCAAATAGCTCGG No data
1102767504_1102767515 28 Left 1102767504 12:115446379-115446401 CCTGAAGGCTTTCTCCTTTACAT No data
Right 1102767515 12:115446430-115446452 CAACTGGGGCTCAAATAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102767515 Original CRISPR CAACTGGGGCTCAAATAGCT CGG Intergenic
No off target data available for this crispr