ID: 1102769194

View in Genome Browser
Species Human (GRCh38)
Location 12:115458743-115458765
Sequence ATGCAAGTCAGTATATATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102769193_1102769194 -9 Left 1102769193 12:115458729-115458751 CCTAAATTAGATATATGCAAGTC No data
Right 1102769194 12:115458743-115458765 ATGCAAGTCAGTATATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102769194 Original CRISPR ATGCAAGTCAGTATATATGT TGG Intergenic
No off target data available for this crispr