ID: 1102771030

View in Genome Browser
Species Human (GRCh38)
Location 12:115476343-115476365
Sequence GTAGACTGATTTTGAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102771030_1102771031 10 Left 1102771030 12:115476343-115476365 CCTGATTTTCAAAATCAGTCTAC No data
Right 1102771031 12:115476376-115476398 ATGTTTAAAGATGTCCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102771030 Original CRISPR GTAGACTGATTTTGAAAATC AGG (reversed) Intergenic
No off target data available for this crispr