ID: 1102772806

View in Genome Browser
Species Human (GRCh38)
Location 12:115493253-115493275
Sequence GGCCGCAGCACAAGTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102772802_1102772806 25 Left 1102772802 12:115493205-115493227 CCATATACCAGCTCTTCTTTTAT No data
Right 1102772806 12:115493253-115493275 GGCCGCAGCACAAGTAAAGTTGG No data
1102772803_1102772806 18 Left 1102772803 12:115493212-115493234 CCAGCTCTTCTTTTATTTCATCG No data
Right 1102772806 12:115493253-115493275 GGCCGCAGCACAAGTAAAGTTGG No data
1102772805_1102772806 -6 Left 1102772805 12:115493236-115493258 CCAGAGCTTAATTGCATGGCCGC No data
Right 1102772806 12:115493253-115493275 GGCCGCAGCACAAGTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102772806 Original CRISPR GGCCGCAGCACAAGTAAAGT TGG Intergenic
No off target data available for this crispr