ID: 1102772879

View in Genome Browser
Species Human (GRCh38)
Location 12:115493880-115493902
Sequence GACCCCCTCTTGGCCCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102772879_1102772887 -7 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772887 12:115493896-115493918 GGGGGTCTGGTGTGCTTGGAAGG No data
1102772879_1102772892 25 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772892 12:115493928-115493950 TATCCATGGTGCCTGGCTGCTGG No data
1102772879_1102772888 -2 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772879_1102772891 18 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data
1102772879_1102772894 29 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772894 12:115493932-115493954 CATGGTGCCTGGCTGCTGGACGG No data
1102772879_1102772889 11 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772889 12:115493914-115493936 GAAGGCCAGGAAAATATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102772879 Original CRISPR GACCCCCTCTTGGCCCCGGG GGG (reversed) Intergenic
No off target data available for this crispr