ID: 1102772888

View in Genome Browser
Species Human (GRCh38)
Location 12:115493901-115493923
Sequence TCTGGTGTGCTTGGAAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102772871_1102772888 20 Left 1102772871 12:115493858-115493880 CCACATCACACTCAGAAGGAAAC No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772881_1102772888 -4 Left 1102772881 12:115493882-115493904 CCCCGGGGCCAAGAGGGGGTCTG No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772880_1102772888 -3 Left 1102772880 12:115493881-115493903 CCCCCGGGGCCAAGAGGGGGTCT No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772879_1102772888 -2 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772882_1102772888 -5 Left 1102772882 12:115493883-115493905 CCCGGGGCCAAGAGGGGGTCTGG No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772869_1102772888 22 Left 1102772869 12:115493856-115493878 CCCCACATCACACTCAGAAGGAA No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772884_1102772888 -6 Left 1102772884 12:115493884-115493906 CCGGGGCCAAGAGGGGGTCTGGT No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data
1102772870_1102772888 21 Left 1102772870 12:115493857-115493879 CCCACATCACACTCAGAAGGAAA No data
Right 1102772888 12:115493901-115493923 TCTGGTGTGCTTGGAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102772888 Original CRISPR TCTGGTGTGCTTGGAAGGCC AGG Intergenic