ID: 1102772891

View in Genome Browser
Species Human (GRCh38)
Location 12:115493921-115493943
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102772879_1102772891 18 Left 1102772879 12:115493880-115493902 CCCCCCGGGGCCAAGAGGGGGTC No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data
1102772884_1102772891 14 Left 1102772884 12:115493884-115493906 CCGGGGCCAAGAGGGGGTCTGGT No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data
1102772881_1102772891 16 Left 1102772881 12:115493882-115493904 CCCCGGGGCCAAGAGGGGGTCTG No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data
1102772880_1102772891 17 Left 1102772880 12:115493881-115493903 CCCCCGGGGCCAAGAGGGGGTCT No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data
1102772882_1102772891 15 Left 1102772882 12:115493883-115493905 CCCGGGGCCAAGAGGGGGTCTGG No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data
1102772885_1102772891 8 Left 1102772885 12:115493890-115493912 CCAAGAGGGGGTCTGGTGTGCTT No data
Right 1102772891 12:115493921-115493943 AGGAAAATATCCATGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102772891 Original CRISPR AGGAAAATATCCATGGTGCC TGG Intergenic