ID: 1102774697

View in Genome Browser
Species Human (GRCh38)
Location 12:115508327-115508349
Sequence CTCAGTGACGAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102774697_1102774701 -5 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774701 12:115508345-115508367 CTGAGTTTCTTTTGAAATAGTGG No data
1102774697_1102774708 28 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774708 12:115508378-115508400 GGCCCAGGAGGCTCAGGGATTGG No data
1102774697_1102774704 13 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774704 12:115508363-115508385 AGTGGGACAGTGTATGGCCCAGG No data
1102774697_1102774705 16 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774705 12:115508366-115508388 GGGACAGTGTATGGCCCAGGAGG No data
1102774697_1102774703 7 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774703 12:115508357-115508379 TGAAATAGTGGGACAGTGTATGG No data
1102774697_1102774702 -4 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774702 12:115508346-115508368 TGAGTTTCTTTTGAAATAGTGGG No data
1102774697_1102774706 22 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774706 12:115508372-115508394 GTGTATGGCCCAGGAGGCTCAGG No data
1102774697_1102774707 23 Left 1102774697 12:115508327-115508349 CCCTCTGCCCTCTCGTCACTGAG No data
Right 1102774707 12:115508373-115508395 TGTATGGCCCAGGAGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102774697 Original CRISPR CTCAGTGACGAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr