ID: 1102777543

View in Genome Browser
Species Human (GRCh38)
Location 12:115533619-115533641
Sequence TAGGCAACTCTGGAGTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102777538_1102777543 26 Left 1102777538 12:115533570-115533592 CCTCAAATGAATGGAAGGTTATT No data
Right 1102777543 12:115533619-115533641 TAGGCAACTCTGGAGTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102777543 Original CRISPR TAGGCAACTCTGGAGTTTTT GGG Intergenic
No off target data available for this crispr