ID: 1102777620

View in Genome Browser
Species Human (GRCh38)
Location 12:115534321-115534343
Sequence ATCTATTTCTTTAAGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102777620_1102777624 -7 Left 1102777620 12:115534321-115534343 CCTTATTTCTTAAAGAAATAGAT No data
Right 1102777624 12:115534337-115534359 AATAGATGGAAACTAAGGGTAGG No data
1102777620_1102777625 0 Left 1102777620 12:115534321-115534343 CCTTATTTCTTAAAGAAATAGAT No data
Right 1102777625 12:115534344-115534366 GGAAACTAAGGGTAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102777620 Original CRISPR ATCTATTTCTTTAAGAAATA AGG (reversed) Intergenic
No off target data available for this crispr