ID: 1102777677

View in Genome Browser
Species Human (GRCh38)
Location 12:115534823-115534845
Sequence AAGAAAAAGGAGGAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102777673_1102777677 -8 Left 1102777673 12:115534808-115534830 CCATGAAGGATTAAGAAGAAAAA No data
Right 1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102777677 Original CRISPR AAGAAAAAGGAGGAGTAGGC AGG Intergenic
No off target data available for this crispr