ID: 1102778335

View in Genome Browser
Species Human (GRCh38)
Location 12:115540785-115540807
Sequence GTGGAGATATAAAGGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102778335_1102778343 30 Left 1102778335 12:115540785-115540807 CCAAGATCCCTTTATATCTCCAC No data
Right 1102778343 12:115540838-115540860 TTCCCTAACATTGAAAGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102778335 Original CRISPR GTGGAGATATAAAGGGATCT TGG (reversed) Intergenic
No off target data available for this crispr