ID: 1102778603

View in Genome Browser
Species Human (GRCh38)
Location 12:115543212-115543234
Sequence CTTTAGGTAATTAGGCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102778603_1102778611 30 Left 1102778603 12:115543212-115543234 CCAATTGGCCTAATTACCTAAAG No data
Right 1102778611 12:115543265-115543287 TACAAAGCCCCTGAGGATGTAGG No data
1102778603_1102778607 4 Left 1102778603 12:115543212-115543234 CCAATTGGCCTAATTACCTAAAG No data
Right 1102778607 12:115543239-115543261 ATCCTATGATAATTCCAGGCTGG No data
1102778603_1102778606 0 Left 1102778603 12:115543212-115543234 CCAATTGGCCTAATTACCTAAAG No data
Right 1102778606 12:115543235-115543257 ACTCATCCTATGATAATTCCAGG No data
1102778603_1102778610 23 Left 1102778603 12:115543212-115543234 CCAATTGGCCTAATTACCTAAAG No data
Right 1102778610 12:115543258-115543280 CTGGCTTTACAAAGCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102778603 Original CRISPR CTTTAGGTAATTAGGCCAAT TGG (reversed) Intergenic
No off target data available for this crispr