ID: 1102783233

View in Genome Browser
Species Human (GRCh38)
Location 12:115583674-115583696
Sequence GTGTTTCAGCAGAAGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102783233_1102783236 22 Left 1102783233 12:115583674-115583696 CCACTTTCCTTCTGCTGAAACAC No data
Right 1102783236 12:115583719-115583741 GAGTTGGCCTTTGCTGCTCTTGG No data
1102783233_1102783235 6 Left 1102783233 12:115583674-115583696 CCACTTTCCTTCTGCTGAAACAC No data
Right 1102783235 12:115583703-115583725 TCATCGCTGATTCTATGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102783233 Original CRISPR GTGTTTCAGCAGAAGGAAAG TGG (reversed) Intergenic
No off target data available for this crispr