ID: 1102783719

View in Genome Browser
Species Human (GRCh38)
Location 12:115586884-115586906
Sequence AACAGGAGGAAGAGAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102783719_1102783725 -3 Left 1102783719 12:115586884-115586906 CCCCTTGCTCTCTTCCTCCTGTT No data
Right 1102783725 12:115586904-115586926 GTTCCGGCCATGTAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102783719 Original CRISPR AACAGGAGGAAGAGAGCAAG GGG (reversed) Intergenic
No off target data available for this crispr