ID: 1102784448

View in Genome Browser
Species Human (GRCh38)
Location 12:115592826-115592848
Sequence GTGGGCAAACAGCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102784448_1102784455 5 Left 1102784448 12:115592826-115592848 CCATCCTCCAGCTGTTTGCCCAC No data
Right 1102784455 12:115592854-115592876 TCAGACACTGCTGGTCAGGCAGG 0: 1
1: 0
2: 5
3: 34
4: 466
1102784448_1102784454 1 Left 1102784448 12:115592826-115592848 CCATCCTCCAGCTGTTTGCCCAC No data
Right 1102784454 12:115592850-115592872 AATATCAGACACTGCTGGTCAGG No data
1102784448_1102784453 -4 Left 1102784448 12:115592826-115592848 CCATCCTCCAGCTGTTTGCCCAC No data
Right 1102784453 12:115592845-115592867 CCACAAATATCAGACACTGCTGG 0: 1
1: 2
2: 1
3: 22
4: 163
1102784448_1102784456 23 Left 1102784448 12:115592826-115592848 CCATCCTCCAGCTGTTTGCCCAC No data
Right 1102784456 12:115592872-115592894 GCAGGATGCCCTCCTTGTCTTGG 0: 1
1: 0
2: 0
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102784448 Original CRISPR GTGGGCAAACAGCTGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr