ID: 1102786339

View in Genome Browser
Species Human (GRCh38)
Location 12:115608107-115608129
Sequence TGACTGGCTACAGGAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786339_1102786347 17 Left 1102786339 12:115608107-115608129 CCTGGGATTCCTGTAGCCAGTCA No data
Right 1102786347 12:115608147-115608169 ATGGTCCACAAATGGATAGAAGG No data
1102786339_1102786341 -10 Left 1102786339 12:115608107-115608129 CCTGGGATTCCTGTAGCCAGTCA No data
Right 1102786341 12:115608120-115608142 TAGCCAGTCACTTCTCCACCTGG No data
1102786339_1102786349 29 Left 1102786339 12:115608107-115608129 CCTGGGATTCCTGTAGCCAGTCA No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786339_1102786343 -2 Left 1102786339 12:115608107-115608129 CCTGGGATTCCTGTAGCCAGTCA No data
Right 1102786343 12:115608128-115608150 CACTTCTCCACCTGGCTGAATGG No data
1102786339_1102786346 9 Left 1102786339 12:115608107-115608129 CCTGGGATTCCTGTAGCCAGTCA No data
Right 1102786346 12:115608139-115608161 CTGGCTGAATGGTCCACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786339 Original CRISPR TGACTGGCTACAGGAATCCC AGG (reversed) Intergenic
No off target data available for this crispr