ID: 1102786340

View in Genome Browser
Species Human (GRCh38)
Location 12:115608116-115608138
Sequence GTGGAGAAGTGACTGGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786340_1102786349 20 Left 1102786340 12:115608116-115608138 CCTGTAGCCAGTCACTTCTCCAC No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786340_1102786346 0 Left 1102786340 12:115608116-115608138 CCTGTAGCCAGTCACTTCTCCAC No data
Right 1102786346 12:115608139-115608161 CTGGCTGAATGGTCCACAAATGG No data
1102786340_1102786347 8 Left 1102786340 12:115608116-115608138 CCTGTAGCCAGTCACTTCTCCAC No data
Right 1102786347 12:115608147-115608169 ATGGTCCACAAATGGATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786340 Original CRISPR GTGGAGAAGTGACTGGCTAC AGG (reversed) Intergenic
No off target data available for this crispr