ID: 1102786342

View in Genome Browser
Species Human (GRCh38)
Location 12:115608123-115608145
Sequence CAGCCAGGTGGAGAAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786342_1102786349 13 Left 1102786342 12:115608123-115608145 CCAGTCACTTCTCCACCTGGCTG No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786342_1102786347 1 Left 1102786342 12:115608123-115608145 CCAGTCACTTCTCCACCTGGCTG No data
Right 1102786347 12:115608147-115608169 ATGGTCCACAAATGGATAGAAGG No data
1102786342_1102786346 -7 Left 1102786342 12:115608123-115608145 CCAGTCACTTCTCCACCTGGCTG No data
Right 1102786346 12:115608139-115608161 CTGGCTGAATGGTCCACAAATGG No data
1102786342_1102786352 26 Left 1102786342 12:115608123-115608145 CCAGTCACTTCTCCACCTGGCTG No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786342 Original CRISPR CAGCCAGGTGGAGAAGTGAC TGG (reversed) Intergenic
No off target data available for this crispr