ID: 1102786344

View in Genome Browser
Species Human (GRCh38)
Location 12:115608135-115608157
Sequence TTGTGGACCATTCAGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786344_1102786352 14 Left 1102786344 12:115608135-115608157 CCACCTGGCTGAATGGTCCACAA No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data
1102786344_1102786349 1 Left 1102786344 12:115608135-115608157 CCACCTGGCTGAATGGTCCACAA No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786344 Original CRISPR TTGTGGACCATTCAGCCAGG TGG (reversed) Intergenic
No off target data available for this crispr