ID: 1102786345

View in Genome Browser
Species Human (GRCh38)
Location 12:115608138-115608160
Sequence CATTTGTGGACCATTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786345_1102786352 11 Left 1102786345 12:115608138-115608160 CCTGGCTGAATGGTCCACAAATG No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data
1102786345_1102786349 -2 Left 1102786345 12:115608138-115608160 CCTGGCTGAATGGTCCACAAATG No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786345 Original CRISPR CATTTGTGGACCATTCAGCC AGG (reversed) Intergenic
No off target data available for this crispr