ID: 1102786349

View in Genome Browser
Species Human (GRCh38)
Location 12:115608159-115608181
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786344_1102786349 1 Left 1102786344 12:115608135-115608157 CCACCTGGCTGAATGGTCCACAA No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786342_1102786349 13 Left 1102786342 12:115608123-115608145 CCAGTCACTTCTCCACCTGGCTG No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786345_1102786349 -2 Left 1102786345 12:115608138-115608160 CCTGGCTGAATGGTCCACAAATG No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786339_1102786349 29 Left 1102786339 12:115608107-115608129 CCTGGGATTCCTGTAGCCAGTCA No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data
1102786340_1102786349 20 Left 1102786340 12:115608116-115608138 CCTGTAGCCAGTCACTTCTCCAC No data
Right 1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786349 Original CRISPR TGGATAGAAGGCCCATCTTC TGG Intergenic