ID: 1102786352

View in Genome Browser
Species Human (GRCh38)
Location 12:115608172-115608194
Sequence CATCTTCTGGTAGAGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786344_1102786352 14 Left 1102786344 12:115608135-115608157 CCACCTGGCTGAATGGTCCACAA No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data
1102786345_1102786352 11 Left 1102786345 12:115608138-115608160 CCTGGCTGAATGGTCCACAAATG No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data
1102786342_1102786352 26 Left 1102786342 12:115608123-115608145 CCAGTCACTTCTCCACCTGGCTG No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data
1102786348_1102786352 -3 Left 1102786348 12:115608152-115608174 CCACAAATGGATAGAAGGCCCAT No data
Right 1102786352 12:115608172-115608194 CATCTTCTGGTAGAGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786352 Original CRISPR CATCTTCTGGTAGAGAGAAA AGG Intergenic
No off target data available for this crispr