ID: 1102786427

View in Genome Browser
Species Human (GRCh38)
Location 12:115608683-115608705
Sequence TGCCTTGAAGATCCGTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102786426_1102786427 -6 Left 1102786426 12:115608666-115608688 CCTGCAAAACTACAAGCTGCCTT No data
Right 1102786427 12:115608683-115608705 TGCCTTGAAGATCCGTCCTTTGG No data
1102786424_1102786427 0 Left 1102786424 12:115608660-115608682 CCTCTCCCTGCAAAACTACAAGC No data
Right 1102786427 12:115608683-115608705 TGCCTTGAAGATCCGTCCTTTGG No data
1102786425_1102786427 -5 Left 1102786425 12:115608665-115608687 CCCTGCAAAACTACAAGCTGCCT No data
Right 1102786427 12:115608683-115608705 TGCCTTGAAGATCCGTCCTTTGG No data
1102786423_1102786427 28 Left 1102786423 12:115608632-115608654 CCATTTGCAGTACTCGTGATGAT No data
Right 1102786427 12:115608683-115608705 TGCCTTGAAGATCCGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102786427 Original CRISPR TGCCTTGAAGATCCGTCCTT TGG Intergenic
No off target data available for this crispr