ID: 1102788822

View in Genome Browser
Species Human (GRCh38)
Location 12:115626498-115626520
Sequence CTGTGTTTAGGGATGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102788822_1102788830 26 Left 1102788822 12:115626498-115626520 CCAAATTCCATCCCTAAACACAG No data
Right 1102788830 12:115626547-115626569 CATAAATATAAGGTATTTCCTGG No data
1102788822_1102788827 16 Left 1102788822 12:115626498-115626520 CCAAATTCCATCCCTAAACACAG No data
Right 1102788827 12:115626537-115626559 GACCCAAGGACATAAATATAAGG No data
1102788822_1102788826 2 Left 1102788822 12:115626498-115626520 CCAAATTCCATCCCTAAACACAG No data
Right 1102788826 12:115626523-115626545 AGCTCAGAAATTCAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102788822 Original CRISPR CTGTGTTTAGGGATGGAATT TGG (reversed) Intergenic
No off target data available for this crispr