ID: 1102789112

View in Genome Browser
Species Human (GRCh38)
Location 12:115629480-115629502
Sequence AAGGCTAGTTAGGAGGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102789103_1102789112 24 Left 1102789103 12:115629433-115629455 CCTCTGTGTTGAAAATAGAACTT No data
Right 1102789112 12:115629480-115629502 AAGGCTAGTTAGGAGGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102789112 Original CRISPR AAGGCTAGTTAGGAGGCTGC CGG Intergenic
No off target data available for this crispr