ID: 1102791200

View in Genome Browser
Species Human (GRCh38)
Location 12:115647272-115647294
Sequence CAGTTCAAGTTGAAAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102791193_1102791200 9 Left 1102791193 12:115647240-115647262 CCCTGTCACAGAGAACATGCCAC No data
Right 1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG No data
1102791192_1102791200 12 Left 1102791192 12:115647237-115647259 CCACCCTGTCACAGAGAACATGC No data
Right 1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG No data
1102791194_1102791200 8 Left 1102791194 12:115647241-115647263 CCTGTCACAGAGAACATGCCACC No data
Right 1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG No data
1102791195_1102791200 -10 Left 1102791195 12:115647259-115647281 CCACCAACAGATCCAGTTCAAGT No data
Right 1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG No data
1102791191_1102791200 13 Left 1102791191 12:115647236-115647258 CCCACCCTGTCACAGAGAACATG No data
Right 1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102791200 Original CRISPR CAGTTCAAGTTGAAAACCTG GGG Intergenic
No off target data available for this crispr