ID: 1102798566

View in Genome Browser
Species Human (GRCh38)
Location 12:115711244-115711266
Sequence TAAACAAGTTGATGAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102798566_1102798567 0 Left 1102798566 12:115711244-115711266 CCAGATTCTCATCAACTTGTTTA No data
Right 1102798567 12:115711267-115711289 CACTGATCAAATCAAGTTTCTGG No data
1102798566_1102798570 29 Left 1102798566 12:115711244-115711266 CCAGATTCTCATCAACTTGTTTA No data
Right 1102798570 12:115711296-115711318 TTAACCCCACAAACGAACTTCGG No data
1102798566_1102798569 2 Left 1102798566 12:115711244-115711266 CCAGATTCTCATCAACTTGTTTA No data
Right 1102798569 12:115711269-115711291 CTGATCAAATCAAGTTTCTGGGG No data
1102798566_1102798568 1 Left 1102798566 12:115711244-115711266 CCAGATTCTCATCAACTTGTTTA No data
Right 1102798568 12:115711268-115711290 ACTGATCAAATCAAGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102798566 Original CRISPR TAAACAAGTTGATGAGAATC TGG (reversed) Intergenic
No off target data available for this crispr