ID: 1102798567

View in Genome Browser
Species Human (GRCh38)
Location 12:115711267-115711289
Sequence CACTGATCAAATCAAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102798565_1102798567 1 Left 1102798565 12:115711243-115711265 CCCAGATTCTCATCAACTTGTTT No data
Right 1102798567 12:115711267-115711289 CACTGATCAAATCAAGTTTCTGG No data
1102798566_1102798567 0 Left 1102798566 12:115711244-115711266 CCAGATTCTCATCAACTTGTTTA No data
Right 1102798567 12:115711267-115711289 CACTGATCAAATCAAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102798567 Original CRISPR CACTGATCAAATCAAGTTTC TGG Intergenic
No off target data available for this crispr