ID: 1102799826

View in Genome Browser
Species Human (GRCh38)
Location 12:115722427-115722449
Sequence CCTAATCTGTAGAAGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102799826_1102799833 25 Left 1102799826 12:115722427-115722449 CCTACCTTCTTCTACAGATTAGG No data
Right 1102799833 12:115722475-115722497 ATTCCTTACTGGCTCATTTCTGG No data
1102799826_1102799830 -5 Left 1102799826 12:115722427-115722449 CCTACCTTCTTCTACAGATTAGG No data
Right 1102799830 12:115722445-115722467 TTAGGGTCAATAATTCCTCTTGG No data
1102799826_1102799832 14 Left 1102799826 12:115722427-115722449 CCTACCTTCTTCTACAGATTAGG No data
Right 1102799832 12:115722464-115722486 TTGGTATGATGATTCCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102799826 Original CRISPR CCTAATCTGTAGAAGAAGGT AGG (reversed) Intergenic
No off target data available for this crispr