ID: 1102800194

View in Genome Browser
Species Human (GRCh38)
Location 12:115725672-115725694
Sequence TGGCATTAAACCCATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102800190_1102800194 -8 Left 1102800190 12:115725657-115725679 CCACTAGTATTTAGATGGCATTA No data
Right 1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG No data
1102800188_1102800194 16 Left 1102800188 12:115725633-115725655 CCACGACAGATACGTATTTGAGA No data
Right 1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102800194 Original CRISPR TGGCATTAAACCCATGGGGC TGG Intergenic
No off target data available for this crispr