ID: 1102804293

View in Genome Browser
Species Human (GRCh38)
Location 12:115765755-115765777
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804293_1102804302 28 Left 1102804293 12:115765755-115765777 CCCCAGGACAGTGGCTGCCGATG No data
Right 1102804302 12:115765806-115765828 CCAGTGCCTCTGTGCATAGAGGG No data
1102804293_1102804300 27 Left 1102804293 12:115765755-115765777 CCCCAGGACAGTGGCTGCCGATG No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804293_1102804297 3 Left 1102804293 12:115765755-115765777 CCCCAGGACAGTGGCTGCCGATG No data
Right 1102804297 12:115765781-115765803 AGCAAGCTGCCTTCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804293 Original CRISPR CATCGGCAGCCACTGTCCTG GGG (reversed) Intergenic
No off target data available for this crispr