ID: 1102804295

View in Genome Browser
Species Human (GRCh38)
Location 12:115765757-115765779
Sequence AACATCGGCAGCCACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804295_1102804300 25 Left 1102804295 12:115765757-115765779 CCAGGACAGTGGCTGCCGATGTT No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804295_1102804297 1 Left 1102804295 12:115765757-115765779 CCAGGACAGTGGCTGCCGATGTT No data
Right 1102804297 12:115765781-115765803 AGCAAGCTGCCTTCATTTCCAGG No data
1102804295_1102804302 26 Left 1102804295 12:115765757-115765779 CCAGGACAGTGGCTGCCGATGTT No data
Right 1102804302 12:115765806-115765828 CCAGTGCCTCTGTGCATAGAGGG No data
1102804295_1102804303 30 Left 1102804295 12:115765757-115765779 CCAGGACAGTGGCTGCCGATGTT No data
Right 1102804303 12:115765810-115765832 TGCCTCTGTGCATAGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804295 Original CRISPR AACATCGGCAGCCACTGTCC TGG (reversed) Intergenic
No off target data available for this crispr