ID: 1102804296

View in Genome Browser
Species Human (GRCh38)
Location 12:115765772-115765794
Sequence GAAGGCAGCTTGCTGAACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804296_1102804302 11 Left 1102804296 12:115765772-115765794 CCGATGTTCAGCAAGCTGCCTTC No data
Right 1102804302 12:115765806-115765828 CCAGTGCCTCTGTGCATAGAGGG No data
1102804296_1102804303 15 Left 1102804296 12:115765772-115765794 CCGATGTTCAGCAAGCTGCCTTC No data
Right 1102804303 12:115765810-115765832 TGCCTCTGTGCATAGAGGGCAGG No data
1102804296_1102804300 10 Left 1102804296 12:115765772-115765794 CCGATGTTCAGCAAGCTGCCTTC No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804296 Original CRISPR GAAGGCAGCTTGCTGAACAT CGG (reversed) Intergenic