ID: 1102804297

View in Genome Browser
Species Human (GRCh38)
Location 12:115765781-115765803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804294_1102804297 2 Left 1102804294 12:115765756-115765778 CCCAGGACAGTGGCTGCCGATGT No data
Right 1102804297 12:115765781-115765803 AGCAAGCTGCCTTCATTTCCAGG No data
1102804293_1102804297 3 Left 1102804293 12:115765755-115765777 CCCCAGGACAGTGGCTGCCGATG No data
Right 1102804297 12:115765781-115765803 AGCAAGCTGCCTTCATTTCCAGG No data
1102804295_1102804297 1 Left 1102804295 12:115765757-115765779 CCAGGACAGTGGCTGCCGATGTT No data
Right 1102804297 12:115765781-115765803 AGCAAGCTGCCTTCATTTCCAGG No data
1102804291_1102804297 18 Left 1102804291 12:115765740-115765762 CCTAAAAGAAAACATCCCCAGGA No data
Right 1102804297 12:115765781-115765803 AGCAAGCTGCCTTCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804297 Original CRISPR AGCAAGCTGCCTTCATTTCC AGG Intergenic